NextSeq 500 paired end sequencing; GSM3271040: HEK293T, NIH/3T3, A549 cells, sci-CAR RNA-seq; Homo sapiens; Mus musculus; RNA-Seq

HEK293T, NIH/3T3, A549 cells, sci-CAR RNA-seq

Here we describe sci-CAR, a combinatorial indexing strategy to jointly profile chromatin accessibility and mRNA in each of thousands of single cells. As a proof-of-concept, we apply sci-CAR to 4,825 cells comprising a time-series of dexamethasone treatment, as well as to 11,233 cells from the mouse kidney. Overall design: single cell RNA-seq and ATAC-seq co-profiling for HEK293T cells, NIH/3T3 cells, A549 cells across three treatment conditions (DEX 0 hour, 1 hour and 3 hour treatment), and wild type mouse kidney.

Joint profiling of chromatin accessibility and gene expression in thousands of single cells

Submitted on 30-AUG-2018

All cell lines (A549, HEK293T and NIH/3T3 cells) were trypsinized, spun down at 300xg for 5 min (4°C) and washed once in 1X PBS. 5M cells were combined and lysed using 1 mL ice-cold cell lysis buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 and 0.1% IGEPAL CA-630, 1% SUPERase In and 1% BSA). The isolated nuclei were then pelleted, washed twice with 500 µL cold lysis buffer without IGEPAL CA-630, and then resuspended in lysis buffer without IGEPAL CA-630 at a final concentration of 5000 nuclei/µL. For all washes, nuclei were pelleted through centrifugation at 500xg for 5 min at 4°C. Mouse kidney was minced to small pieces by blade in cell lysis buffer and transferred to the top of a 40um cell strainer (Falcon). Kidney tissues were homogenized with the rubber tip of a syringe plunger (5ml, BD) in 4ml cell lysis buffer. The filtered nuclei were then transferred to a new 15ml tube (Falcon) and pelleted by centrifuge at 500g for 5min and washed once with 1ml cell lysis buffer. The nuclei were fixed in 4ml ice cold 4% paraformaldehyde (EMS) for 15min on ice. After fixation, the nuclei were washed twice in 1ml nuclei wash buffer (cell lysis buffer without IGEPAL), and re-suspended in 500ul nuclei wash buffer. The samples were split to 5 tubes with 100ul in each tube and flash frozen in liquid nitrogen. Nuclei were then distributed into one 96-well plate. For each well, 5,000 nuclei (2 µL) were mixed with 1 µl of 25 µM anchored oligo-dT primer (5′-ACGACGCTCTTCCGATCTNNNNNNNN[10bp index]TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3′, where “N” is any base and “V” is either “A”, “C” or “G”; IDT) and 0.25 µL 10 mM dNTP mix (Thermo), denatured at 55°C for 5 min and immediately placed on ice. 1.75 µL of first-strand reaction mix, containing 1 µL 5X Superscript IV First-Strand Buffer (Invitrogen), 0.25 µl 100 mM DTT (Invitrogen), 0.25 µl SuperScript IV reverse transcriptase (200 U/μl, Invitrogen), 0.25 μL RNaseOUT Recombinant Ribonuclease Inhibitor (Invitrogen), was then added to each well. Reverse transcription was carried out by incubating plates by gradient temperature (4°C 2 minutes, 10°C 2 minutes, 20°C 2 minutes, 30°C 2 minutes, 40°C 2 minutes, 50°C 2 minutes and 55°C 10 minutes). 3 μL cell lysis buffer without IGEPAL CA-630, 10 μL Nextera TD buffer (Illumina) and 1 to 2 μL indexed TDE1 enzyme (Illumina) were added to each well. Tagmentation was performed at 55°C for 30 min and stopped by adding 5 μl 2X stop solution (40 mM EDTA, 1 mM spermidine) to each well. All cells (or nuclei) were then pooled, stained with 4',6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM, and sorted at 25 nuclei per well into 5 μL EB buffer. Cells are gated based on DAPI stain such that singlets are discriminated from doublets and sorted into the each well. 0.66 μl mRNA Second Strand Synthesis buffer (NEB) and 0.34 μl mRNA Second Strand Synthesis enzyme (NEB) were then added to each well, and second strand synthesis was carried out at 16°C for 180 min. The reaction was then stopped by adding 6 μL DNA binding buffer (Zymo) and incubating at room temperature for 5 min. Each well was then purified using 24 uL AMPure XP beads (Beckman Coulter), eluted in 12.5 μL of buffer EB (Qiagen). Eluted product was then split (6 μL each) and transferred to two new 96-well plates.  For one plate (RNA-seq half), each well was mixed with 5 μL Nextera TD buffer (Illumina) and 1 μL i7 only TDE1 enyzme (25nM, Illumina), and then incubated at 55°C for 5 min to carry out tagmentation. After tagmentation, each well was mixed with 0.4 μL 1% SDS, 0.4 μL BSA (NEB), and 2 μL of 10 μM P7 primer (5′-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG-3′, IDT), and incubated at 55°C for 15 min. Then each well was then added with 2 μL 10% Tween-20, 1.2 μL nuclease-free water, 2μL of 10 μM indexed P5 primer (5′-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′; IDT), and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification was carried out using the following program: 72°C for 5 min, 98°C for 30 sec, 18-22 cycles of (98°C for 10 sec, 66°C for 30 sec, 72°C for 1 min) and a final 72°C for 5 min. For sci-RNA-seq only branch of the workflow, after second strand synthesis, instead of cell lysis and ampure beads purification, all cells were used for tagmentation and following PCR reaction with the same procedure as co-assay. After PCR, samples were pooled and purified using 0.8 volumes of AMPure XP beads. Library concentrations were determined by Qubit (Invitrogen) and the libraries were visualized by electrophoresis on a 6% TBE-PAGE gel. All RNA-seq libraries were sequenced on the NextSeq 500 platform (Illumina) using a V2 75 cycle kit (Read 1: 18 cycles, Read 2: 52 cycles, Index 1: 10 cycles, Index 2: 10 cycles). The co-assay RNA-seq library was sequenced to saturate (~100k reads per cell) and the sci-RNA-seq library was sequenced to 16k reads per cell.  For the other plate (ATAC-seq half), each well was mixed with 1μL of 10 μM indexed P5 primer (5′- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC-3′; IDT), 1 μL of 10 μM P7 primer (5′-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG-3′, IDT), 2 μL nuclease-free water, and 10 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification was carried out using the following program: 72°C for 3 min, 98°C for 30 sec, 18-22 cycles of (98°C for 10 sec, 63°C for 30 sec, 72°C for 1 min) and a final 72°C for 5 min. For sci-ATAC-seq only branch of the work flow, sorted cells were processed similarly with published method (31) with minor modifications: each well was mixed with 7 μL buffer EB (Qiagen), 0.4 μL 1% SDS, 0.4 μL BSA (NEB), and 2 μL of 10 μM P7 primer (5′-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG-3′, IDT), and incubated at 55°C for 15 min. Then each well was then added with 2 μL 10% Tween-20, 1.2 μL nuclease-free water, 2μL of 10 μM indexed P5 primer (5′- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC-3′; ID), and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification procedure was the same with ATAC-seq in co-assay. After PCR, all samples were pooled and purified using 1 volumes of AMPure XP beads. Gel extraction was applied to remove primer dimers shorter than 200bp. Library concentrations were determined by Qubit (Invitrogen) and the libraries were visualized by electrophoresis on a 6% TBE-PAGE gel. Libraries were sequenced on a NextSeq 500 platform (Illumina) using a mid-output 300 cycle kit and a custom recipe (paired end 51bp reads with index reads that covered both the Tn5 barcode and the library amplification barcode) and custom primers as described before. The ATAC-seq libraries was sequenced to around 55,000 reads per cell. Fixed nuclei (by paraformaldehyde, mouse kidney) were process in similar steps of cultured cells with minor modifications: Thawed nuclei are permeabilized with 0.2% tritonX-100 for 3 minutes on ice, washed twice with nuclei wash buffer. After sorting, each well was mixed with 6 μL EB buffer, 0.5 μL 1% SDS, 0.5 μL protease K (Qiagen), and incubated at 65 °C for 16 hours to reverse crosslinking. 2 μL 10% tween-20 was added to each well, and 6 μL of mix was transferred to a fresh 96-well plate for ATAC-seq library preparation: each well was mixed with 2μL of 10 μM indexed P5 primer (5′- AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC-3′; IDT), 2 μL of 10 μM P7 primer (5′-CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG-3′, IDT), 8 μL nuclease-free water, 1 μL 10% tween-20, 1 μL BSA (NEB) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification program and following steps for ATAC-seq were the same with fresh nuclei.  The cell lysate for RNA-seq library preparation was purified using 2 volumes of AMPure XP beads and eluted in 5 μL elution buffer. 0.66 μl mRNA Second Strand Synthesis buffer (NEB) and 0.34 μl mRNA Second Strand S

Joint profiling of chromatin accessibility and gene expression in thousands of single cells

Submitter Supplied Information

Samples