NextSeq 500 paired end sequencing; GSM3490847: A1.1001200160; Mus musculus; RNA-Seq

A1.1001200160

We generated single-cell RNAseq profiles of 369 microglia (183 from wild type and 186 from Trem2 knock-out), sorted in the gate CD45lowCD11+ or CD45lowCD11+Gpnmb+Clec7a+ (PAM enrichment), to compare gene expression of wild type vs. Trem2 knock-out microglia on the postnatal day 7. Single cells were FACS index sorted from the whole brain followed by Smart-seq2 library preparation and Illumina Nextseq (sequence depth > 1 million per cell). A total of 334 cells passed quality control for data analysis. Microglia in the Trem2 knock-out contained a similar PAM population with characteristic gene expression, suggesting that the presence of early postnatal PAM do not depend on TREM2. Overall design: Single microglia were FACS sorted from male animals (C57BL/6J background) into 96-well plates. Libraries were prepared with a semi-automated Smart-seq2 protocol. Three QC criteria were used (Y=passed, N=not passed), and only cells that passed all three criteria were used for downstream analysis.

Deep single-cell RNAseq of postnatal day 7 microglia from wild type and Trem2 knockout brains

Submitted on 01-JAN-2019

The whole brain was dissected out and put into a 6cm petri dish with 200ul cold medium A on ice (15mM HEPES, 0.5% glucose in 1 X Hanks' Balanced Salt Solution (HBSS without phenol red)). Microglia extraction was carried out on ice following a published protocol (Bennett et al. PNAS. 2016) through douncing, MACS myelin removal and FACS staining. Single live cells in the CD45lowCD11b+ or CD45lowCD11b+Gpnmb+Clec7a+ gate were sorted into 96-well plates for library preparation. Sequencing libraries were prepared following the published Smart-seq2 protocol with the aid of liquid handling robotics (Picelli et al. Nature Protocols. 2014). Briefly, plates with sorted cells were thawed on ice and incubated at 72˚C for 3 min in order to anneal RNAs to the Oligo-dT30VN primer. After that, 6ul reverse transcription mixture (95U SMARTScribe™ Reverse Transcriptase (100U/ul, Clontech 639538), 10U RNase inhibitor (40U/ul), 1XFirst-Strand buffer, 5mM DTT, 1M Betaine, 6mM MgCl2, 1uM TSO (Exiqon, Rnase free HPLC purified)) was added into each well, and RT was performed at 42˚C for 90 min, followed by 70˚C, 5 min. To amplify cDNA, 15ul PCR amplification mix (1X KAPA HIFI Hotstart Master Mix (Kapa Biosciences KK2602), 0.1uM ISPCR Oligo (AAGCAGTGGTATCAACGCAGAGT), 0.56U Lambda Exonuclease (5U/ul, New England BioLabs M0262S)) was added, and the following PCR program was used: (1) 37˚C 30 min; (2)95˚C 3 min; (3) 21 cycles of 98˚C 20 sec, 67˚C 15 sec, 72˚C 4 min; (4) 72˚C 5 min. Amplified cDNA samples were then purified with PCRClean DX beads (0.7:1 ratio, Aline C-1003-50), and resuspended in 20ul EB buffer. cDNA quality was examined with a Fragment Analyzer (AATI, High Sensitivity NGS Fragment Analysis Kit:1 bp - 6000 bp) following the manufacture's instruction. Samples with sufficient amount of cDNA content (>0.05ng/ul) and normal peaks on the quantification graphs were retained for library preparation. To make libraries, all samples were first diluted down to 0.15ng/ul (only if higher than 0.15ng/ul) in 384-well plates using Mantis Liquid Handler (Formulatrix) and Mosquito X1 (TTP Labtech) with customized scripts. Nextera XT DNA Sample Prep Kit (Illumina FC-131-1096) was used at 1/10 of recommendation volume, with the help of a Mosquito HTS robot for liquid transfer. Specifically, tagmentation was done in 1.6ul (1.2ul Tagment enzyme mix, 0.4ul diluted cDNA) at 55˚C, 10 min. Neutralization buffer was added 0.4ul per well and incubated at room temperature for 5 min to stop the reaction. Then 0.8ul Illumina Nextera XT 384 Indexes (0.4ul each, 5uM from 4 sets of 96 indexes) and 1.2ul PCR master mix were added to amplify whole transcriptomes using the following program: (1) 72˚C 3 min; (2) 95˚C 30 sec; (3) 10 cycles of 95˚C 10 sec, 55˚C 30 sec, 72˚C 1 min; (4) 72˚C 5 min. Libraries from a single 384 plate were pooled together in an Eppendorf tube and purified twice with PCRClean DX beads. The quality and concentrations of the final mixed libraries were measured with Bioanalyzer and Qubit, respectively, before Illumina Nextseq sequencing.

Deep single-cell RNAseq of postnatal day 7 microglia from wild type and Trem2 knockout brains

Submitter Supplied Information

Samples