Filters
Technology
Platform
GSE54957
Homo sapiens
5 Downloadable Samples
Affymetrix Human Transcriptome Array 2.0 (hta20), Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version)
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
Functional analysis of the TRIB1 associated locus linked to plasma triglycerides and coronary artery disease.
Sample Metadata Fields
Cell line
View Samples- Homo sapiens
- 5 Downloadable Samples
- Affymetrix Human Transcriptome Array 2.0 (hta20), Agilent-028004 SurePrint G3 Human GE 8x60K Microarray (Probe Name Version)
Description
Objective - The TRIB1 locus has been linked to hepatic triglyceride metabolism in mice and to plasma triglycerides and coronary artery disease (CAD) in humans. The lipid associated SNPs identified by genome-wide association studies (GWAS) are located ~ 30 kb downstream from TRIB1 suggesting complex regulatory effects on genes or pathways relevant to hepatic triglyceride metabolism. The goal of this study was to investigate the functional relationship between common SNPs at the TRIB1 locus and plasma lipid traits.
Publication Title
Functional analysis of the TRIB1 associated locus linked to plasma triglycerides and coronary artery disease.
Sample Metadata Fields
Cell line
View Samples- Homo sapiens
- 3 Downloadable Samples
Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Mus musculus
- 107 Downloadable Samples
Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 2 Downloadable Samples
Description
Organoid technologies provide an accessible system in which to examine the generation, self-organization,and 3-dimensional cellular interactions during development of the human cerebral cortex. However, oligodendrocytes, the myelinating glia of the central nervous system and third major neural cell type, are conspicuously absent from current protocols. Here we reproducibly generate human oligodendrocytes and myelin in pluripotent stem cell-derived cortical spheroids. Transcriptional and immunohistochemical analysis of the spheroids demonstrates molecular features consistent with maturing human oligodendrocytes within 14 weeks of culture, including expression of MyRF, PLP1, and MBP proteins. Histological analysis by electron microscopy shows initial wrapping of human neuronal axons with myelin by 20 weeks and maturation to compact myelin by 30 weeks in culture. Treatment of spheroids with previously identified promyelinating drugs enhances the rate and extent of human oligodendrocyte generation and myelination. Furthermore, generation of spheroids from patients with a severe genetic myelin disorder, Pelizaeus-Merzbacher disease, demonstrates the ability to recapitulate human disease phenotypes, which were in turn improved with both pharmacologic and CRISPR-based approaches. Collectively, these 3-dimensional, multi-lineage cortical spheroids provide a versatile platform to observe and perturb the complex cellular interactions that occur during developmental myelination of the brain and offer new opportunities for disease modeling and therapeutic development in human tissue. Overall design: RNAseq profiles comparing neuro-cortical spheroids and oligo-cortical spheroids
Publication Title
Induction of myelinating oligodendrocytes in human cortical spheroids.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 72 Downloadable Samples
- Illumina HiSeq 2000
Description
The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Publication Title
Stochastic principles governing alternative splicing of RNA.
Sample Metadata Fields
Subject
View Samples- Mus musculus
- 9 Downloadable Samples
- Affymetrix Murine Genome U74A Version 2 Array (mgu74av2), Affymetrix Murine Genome U74A Array (mgu74a)
Description
Biological comparison of gene expression profiles of adult male whole Muta™Mouse lung with its immortalized 100% confluent epithelial lung cell line counterpart. White, P.A.,et al. 2003. Development and characterization of an epithelial cell line from Muta™Mouse lung. Environ Mol Mutagen 42,3 pgs 166-184
Publication Title
Comprehensive comparison of six microarray technologies.
Sample Metadata Fields
Sex, Specimen part, Cell line, Subject
View Samples- Arabidopsis thaliana
- 6 Downloadable Samples
- Affymetrix Arabidopsis ATH1 Genome Array (ath1121501)
Description
BP and ER encode proteins that act synergistically to regulate Arabidopsis inflorescence architecture. To search for genes/proteins that influence the BP/ER signaling pathways, we conducted mutagenesis of the bp er double mutant and found that a mutation in FILAMENTOUS FLOWER (FIL) suppresses many of the morphological/developmental defects in bp er. Given that FIL encodes a Zn-finger containing transcription factor, microarray analysis was conducted on bp er vs. the bp er fil line to identify genes that are misregulated and which might implicate specific genes/proteins/pathways that are involved in regulating inflorescence development.
Publication Title
A novel Filamentous Flower mutant suppresses brevipedicellus developmental defects and modulates glucosinolate and auxin levels.
Sample Metadata Fields
No sample metadata fields
View Samples