Filters
Technology
Platform
Mus musculus
12 Downloadable Samples
Illumina HiSeq 2000
Description
Purpose: Our lab has previously shown that Scleraxis (Scx) is require for proper valve development in vivo. In order to fully explore gene networks regulated by Scx during the vital stages of valve remodeling , high throughput RNA-squencing was performed. Results:There were a total of 18,810 genes were detected. A total of 864 genes were differentially expressed Scx null AVC regions: 645 being upregulated and 217 downregulated. Overall design: In this data set, we include expression data from atrioventricular canal (AVC) regions from Scx null and wild-type littermate controls at embryonic day 15.5. A total of 6 samples were analyzed; 3 valve regions from E15.5 Scx-/- mice, and 3 from E15.5 Scx+/+ wild-type littermate controls. Differential expression read counts are ranked based on p-value (<0.05).
Publication Title
RNA-seq analysis to identify novel roles of scleraxis during embryonic mouse heart valve remodeling.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 6 Downloadable Samples
- Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples
SRP159079- Homo sapiens
- 8 Downloadable Samples
- Illumina HiSeq 2000
Description
Human Tregs isolated from PBMCs were cultured in the absence or presence of IL-12 (20ng/ml) for four days and were performed mRNA-seq. Overall design: mRNA profiles of human Treg stimulated with IL-12 (Th1 condition)
Publication Title
Activated β-catenin in Foxp3<sup>+</sup> regulatory T cells links inflammatory environments to autoimmunity.
Sample Metadata Fields
Age, Subject
View Samples GSE22176- Homo sapiens
- 78 Downloadable Samples
Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
A ChIP-seq defined genome-wide map of vitamin D receptor binding: associations with disease and evolution.
Sample Metadata Fields
Cell line, Time
View Samples- Homo sapiens
- 54 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Genome-wide expression analysis of hapmap lymphoblastoid and ENCODE project cell lines stimulated with calcitriol
Publication Title
A ChIP-seq defined genome-wide map of vitamin D receptor binding: associations with disease and evolution.
Sample Metadata Fields
Cell line, Time
View Samples- Homo sapiens
- 24 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Genome-wide expression analysis of hapmap lymphoblastoid and ENCODE project cell lines stimulated with calcitriol and/or estrogen
Publication Title
A ChIP-seq defined genome-wide map of vitamin D receptor binding: associations with disease and evolution.
Sample Metadata Fields
Cell line, Time
View Samples- Homo sapiens
- 251 Downloadable Samples
- Affymetrix Human Gene 2.0 ST Array (hugene20st)
Description
593 FFPE colorectal cancer samples were used to generate three prediction models: Recurrence prediction, 5FU efficacy prediction, and FOLFOX efficacy prediction
Publication Title
Building personalized treatment plans for early-stage colorectal cancer patients.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Expression 430A Array (moe430a)
Description
We performed microarray analysis to examine the differential gene expression profiles between Prdm1 (Blimp-1)-deleted and control keratinocytes. Keratinocytes isolated from Prdm1-floxed K5-CreER positive (CKO) mice were cultured in the presence of 4OHT to induce deletion of the Prdm1 allele in vitro. Prdm1-floxed K5-CreER positive (CKO) keratinocytes treated with the ethanol solvent control (EtOH) or Prdm1-floxed K5-CreER negative (control) keratinocytes treated with 4OHT or EtOH served as controls. Microarray analyses revealed that there were 93 genes up-regulated and 109 genes down-regulated by more than 2-fold in the CKO + 4OHT group in comparison with the CKO + EtOH, Ctrl + 4OHT or Ctrl + EtOH groups. Several corneocytes-related genes, including Rptn, Lce1f, Krt1 and Lce1d, are significantly down-regulated and several cytokines/chemokines, including Cxcl1, Cxcl2, Cxcl5 and Il24, are significantly up-regulated upon the deletion of Prdm1 in vitro.
Publication Title
Inducible deletion of the Blimp-1 gene in adult epidermis causes granulocyte-dominated chronic skin inflammation in mice.
Sample Metadata Fields
Specimen part, Treatment
View Samples- Homo sapiens
- 5 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Abstract
Publication Title
Breast cancer-associated fibroblasts confer AKT1-mediated epigenetic silencing of Cystatin M in epithelial cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Anopheles gambiae
- 15 Downloadable Samples
- Affymetrix Plasmodium/Anopheles Genome Array (plasmodiumanopheles)
Description
Although the basic anatomical sub-divisions of the larval mosquito gut were established several decades ago, information regarding their exact physiological roles is rather scarce. Several studies have reported differences between larval gut compartments in various morphological and physiological aspects. Unfortunately, the fragmentary and incomplete nature of this information makes it hard to establish clear links to the specific and/or unique physiological roles of each gut region.
Publication Title
A microarray-based analysis of transcriptional compartmentalization in the alimentary canal of Anopheles gambiae (Diptera: Culicidae) larvae.
Sample Metadata Fields
No sample metadata fields
View Samples